Stem-loop sequence dre-mir-27e

AccessionMI0001932
DescriptionDanio rerio miR-27e stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         --ac      ac     a           aucg       u ga  cc 
5' gucauc    ucgcuc  ggcgc gagcuuagcua    gugagca u  uc  u
   ||||||    ||||||  ||||| |||||||||||    ||||||| |  ||   
3' caguag    agugag  cugug cuugaaucggu    cacuugu a  ag  u
         ggca      gu     a           --ga       c aa  aa 
Get sequence
Deep sequencing
467 reads, 84.6 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
22: 5004330-5004435 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-27e
dre-mir-23a-122: 4997592-4997680 [+]
dre-mir-27e22: 5004330-5004435 [+]
dre-mir-24-422: 5011864-5011953 [+]
Database links

Mature sequence dre-miR-27e

Accession MIMAT0001800
Sequence

65 - 

uucacaguggcuaaguucagug

 - 86

Get sequence
Deep sequencing408 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).