Stem-loop sequence dre-mir-29b-2

AccessionMI0001934
DescriptionDanio rerio miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u       c   -           c      gu      -g  uu 
5'  cuuccuc aga ugcugguuuca auggug  uuagau  ug  c
    ||||||| ||| ||||||||||| ||||||  ||||||  ||   
3'  ggagggg ucu gugacuaaagu uaccac  gaucug  ac  u
   g       u   u           u      --      aa  ca 
Get sequence
Deep sequencing
133 reads, 49.5 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 10672720-10672807 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-29b-2
dre-mir-29b-24: 10672720-10672807 [-]
dre-mir-29a4: 10671282-10671407 [-]
Database links

Mature sequence dre-miR-29b

Accession MIMAT0001801
Sequence

55 - 

uagcaccauuugaaaucagugu

 - 76

Get sequence
Deep sequencing262 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).