Stem-loop sequence dre-mir-29a

AccessionMI0001938
Previous IDsdre-mir-29a-1
DescriptionDanio rerio miR-29a stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u     cccucaucucucucucucuc      ccaaacg            cuu       u   - u cc 
5'  gaaga                    ucccca       augacugauuuc   uggugcu aga g c  a
    |||||                    ||||||       ||||||||||||   ||||||| ||| | |   
3'  cuucu                    aggggu       uauuggcuaaag   accacga ucu c g  u
   a     ---------------uaacu      -caguaa            uuu       -   a u uc 
Get sequence
Deep sequencing
476 reads, 161 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 10671282-10671407 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-29a
dre-mir-29b-24: 10672720-10672807 [-]
dre-mir-29a4: 10671282-10671407 [-]
Database links

Mature sequence dre-miR-29a

Accession MIMAT0001802
Sequence

81 - 

uagcaccauuugaaaucgguua

 - 102

Get sequence
Deep sequencing363 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).