Stem-loop sequence dre-mir-30a

AccessionMI0001940
DescriptionDanio rerio miR-30a stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      uc  u c   u         ccc            ua  gc 
5' ggc  cu g agu guaaacauu   gacuggaaguug  au  a
   |||  || | ||| |||||||||   ||||||||||||  ||  g
3' ccg  gg c ucg cguuuguag   cugacuuucgac  ua  a
      gu  u a   u         --u            uc  aa 
Get sequence
Deep sequencing
6181 reads, 535 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
19: 4497677-4497765 [+]
intergenic
Database links

Mature sequence dre-miR-30a-5p

Accession MIMAT0001803
Previous IDsdre-miR-30a
Sequence

14 - 

uguaaacauucccgacuggaag

 - 35

Get sequence
Deep sequencing232 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-30a-3p

Accession MIMAT0031951
Sequence

57 - 

cuuucagucugauguuugcugc

 - 78

Get sequence
Deep sequencing112 reads, 2 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).