Stem-loop sequence dre-mir-30b

AccessionMI0001941 (change log)
Previous IDsdre-mir-30b-1
DescriptionDanio rerio miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

11 open access papers mention dre-mir-30b
(118 sentences)

Stem-loop
   u     ugu      u           a a       gugag u 
5'  uccag   agucgc guaaacauccu c cucagcu     c g
    |||||   |||||| ||||||||||| | |||||||     |  
3'  agguc   ucagug cguuuguggga g gggucgg     g c
   g     -ug      u           g c       -agca a 
Get sequence
Deep sequencing
8971 reads, 564 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 25341724-25341811 [+]
antisense
OTTDART00000059997 ; si:dkey-29h14.11-001; exon 2
ENSDART00000153750 ; si:dkey-29h14.11-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-30b
dre-mir-30dchr16: 25341416-25341543 [+]
dre-mir-30bchr16: 25341724-25341811 [+]
Database links

Mature sequence dre-miR-30b

Accession MIMAT0001804
Sequence

16 - 

uguaaacauccuacacucagcu

 - 37

Get sequence
Deep sequencing8812 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).