Stem-loop sequence dre-mir-30b

AccessionMI0001941 (change log)
Previous IDsdre-mir-30b-1
DescriptionDanio rerio miR-30b stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u     ugu      u           a a       gugag u 
5'  uccag   agucgc guaaacauccu c cucagcu     c g
    |||||   |||||| ||||||||||| | |||||||     |  
3'  agguc   ucagug cguuuguggga g gggucgg     g c
   g     -ug      u           g c       -agca a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 25341724-25341811 [+]
antisense
OTTDART00000059997 ; si:dkey-29h14.11-001; exon 2
ENSDART00000153750 ; si:dkey-29h14.11-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-30b
dre-mir-30dchr16: 25341416-25341543 [+]
dre-mir-30bchr16: 25341724-25341811 [+]
Database links

Mature sequence dre-miR-30b

Accession MIMAT0001804
Sequence

16 - 

uguaaacauccuacacucagcu

 - 37

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).