Stem-loop sequence dre-mir-30c

AccessionMI0001944 (change log)
Previous IDsdre-mir-30c-1
DescriptionDanio rerio miR-30c stem-loop
Gene family MIPF0000005; mir-30
Literature search

12 open access papers mention dre-mir-30c
(133 sentences)

Stem-loop
   cu                   ua       a   gga    
5'   ucagggaguguaaacaucc  cacucuc gcu   gcg 
     |||||||||||||||||||  ||||||| |||   || c
3'   ggucucucgcguuuguagg  gugaggg cgg   cga 
   uc                   --       c   agc    
Get sequence
Deep sequencing
24249 reads, 1.18e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr13: 27804067-27804145 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-30c
dre-mir-30e-2chr13: 27795130-27795209 [+]
dre-mir-30cchr13: 27804067-27804145 [+]
Database links

Mature sequence dre-miR-30c-5p

Accession MIMAT0001805
Previous IDsdre-miR-30c
Sequence

11 - 

uguaaacauccuacacucucag

 - 32

Get sequence
Deep sequencing24071 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-30c-3p

Accession MIMAT0031952
Sequence

50 - 

ccgggagugggauguuugcgcu

 - 71

Get sequence
Deep sequencing178 reads, 9 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).