Stem-loop sequence dre-mir-30d

AccessionMI0001946 (change log)
Previous IDsdre-mir-30d-1
DescriptionDanio rerio miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

10 open access papers mention dre-mir-30d
(119 sentences)

Stem-loop
   gugcu     u  - -  u      u  uuc   c u          cc           -  --g  a 
5'      guaua gg g ua aacugg ug   aug c guaaacaucc  gacuggaagcu gu   cu c
        ||||| || | || |||||| ||   ||| | ||||||||||  ||||||||||| ||   ||  
3'      uaugu cc c gu uugacc gc   uac g cguuuguagg  uugacuuucga ca   gg g
   --cau     u  g u  c      u  ---   u u          --           g  aaa  c 
Get sequence
Deep sequencing
80714 reads, 4.01e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 25341416-25341543 [+]
antisense
OTTDART00000059997 ; si:dkey-29h14.11-001; exon 2
ENSDART00000153750 ; si:dkey-29h14.11-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-30d
dre-mir-30dchr16: 25341416-25341543 [+]
dre-mir-30bchr16: 25341724-25341811 [+]
Database links

Mature sequence dre-miR-30d

Accession MIMAT0001806
Sequence

35 - 

uguaaacauccccgacuggaag

 - 56

Get sequence
Deep sequencing77938 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).