Stem-loop sequence dre-mir-30e-2

AccessionMI0001950
DescriptionDanio rerio miR-30e-2 stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uacg    a            uu           ggug a 
5'     ggcu cuguaaacaucc  gacuggaagcu    c c
       |||| ||||||||||||  |||||||||||    |  
3'     ccga gacguuuguagg  cugacuuucga    g a
   ucaa    c            --           ggua u 
Get sequence
Deep sequencing
44996 reads, 4.21e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
13: 28019020-28019099 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-30e-2
dre-mir-30e-213: 28019020-28019099 [+]
dre-mir-30c13: 28027957-28028035 [+]
Database links

Mature sequence dre-miR-30e-5p

Accession MIMAT0001807
Previous IDsdre-miR-30e
Sequence

11 - 

uguaaacauccuugacuggaag

 - 32

Get sequence
Deep sequencing38854 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-30e-3p

Accession MIMAT0003402
Previous IDsdre-miR-30e*
Sequence

51 - 

cuuucagucggauguuugcagc

 - 72

Get sequence
Deep sequencing2251 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).