Stem-loop sequence dre-mir-92a-1

AccessionMI0001951 (change log)
DescriptionDanio rerio miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Literature search

9 open access papers mention dre-mir-92a-1
(30 sentences)

Stem-loop
   ugguc     cugc            u   a        gugug 
5'      ccuuu    gcagguugggau ggu gcaaugcu     u
        |||||    |||||||||||| ||| ||||||||      
3'      ggaaa    uguccggcccug uca cguuaugg     u
   uguua     ----            u   -        aaguu 
Get sequence
Deep sequencing
278991 reads, 1.68e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 3297367-3297451 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-92a-1
dre-mir-17a-1chr1: 3298112-3298249 [-]
dre-mir-18achr1: 3298006-3298088 [-]
dre-mir-19achr1: 3297848-3297936 [-]
dre-mir-20achr1: 3297603-3297755 [-]
dre-mir-19bchr1: 3297484-3297570 [-]
dre-mir-92a-1chr1: 3297367-3297451 [-]
Database links

Mature sequence dre-miR-92a-5p

Accession MIMAT0031953
Sequence

17 - 

agguugggauugguagcaaugcu

 - 39

Get sequence
Deep sequencing4717 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-92a-3p

Accession MIMAT0001808
Previous IDsdre-miR-92a
Sequence

54 - 

uauugcacuugucccggccugu

 - 75

Get sequence
Deep sequencing523273 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).