Stem-loop sequence dre-mir-92a-2

AccessionMI0001952 (change log)
DescriptionDanio rerio miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

10 open access papers mention dre-mir-92a-2
(30 sentences)

Stem-loop
       ca    --u     ug           c  cc        -  g 
5' acag  uccc   uucuu  cagguugggau gg  gcaaugcu cu u
   ||||  ||||   |||||  ||||||||||| ||  |||||||| || g
3' uguu  aggg   gagaa  guccggcccug uc  cguuauga gg c
       aa    uac     gu           u  -a        a  u 
Get sequence
Deep sequencing
251460 reads, 1.52e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 53436280-53436374 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-92a-2
dre-mir-17a-2chr9: 53436944-53437026 [-]
dre-mir-18bchr9: 53436831-53436917 [-]
dre-mir-92a-2chr9: 53436280-53436374 [-]
Database links

Mature sequence dre-miR-92a-2-5p

Accession MIMAT0031954
Sequence

20 - 

agguugggaucggccgcaaugcu

 - 42

Get sequence
Deep sequencing2450 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-92a-3p

Accession MIMAT0001808
Previous IDsdre-miR-92a
Sequence

55 - 

uauugcacuugucccggccugu

 - 76

Get sequence
Deep sequencing523273 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).