Stem-loop sequence dre-mir-92b

AccessionMI0001953
DescriptionDanio rerio miR-92b stem-loop
Gene family MIPF0000013; mir-25
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-92_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-92 microRNAs are short single stranded non-protein coding RNA fragments initially discovered incorporated into an RNP complex with a proposed role of processing RNA molecules and further RNP assembly. Mir-92 has been mapped to the human genome as part of a larger cluster at chromosome 13q31.3, where it is 22 nucleotides in length but exists in the genome as part of a longer precursor sequence. There is an exact replica of the mir-92 precursor on the X chromosome. MicroRNAs are endogenous triggers of the RNAi pathway which involves several ribonucleic proteins (RNPs) dedicated to repressing mRNA molecules via translation inhibition and/or induction of mRNA cleavage. miRNAs are themselves matured from their long RNA precursors by ribonucleic proteins as part of a 2 step biogenesis mechanism involving RNA polymerase 2. Most miRNAs are grouped into clusters in the human genome or within families that share functions, expression profiles, promotors, or are incorporated into the same ribonucleic protein. The purpose of having a variety of miRNAs in a single peace of RNA processing machinery is to act as complementary strands to the recognition elements of a variety of target RNA molecules. The recognition elements of target mRNAs are typically within the 3' untranslated regions and with 678 human miRNAs and 472 mouse miRNAs confidently identified so far (miRBASE) there are extensive efforts taking place using bioinformatics tools to scan genomes for potential recognition elements for families of miRNAs in order to identify potential target genes. Mir-92 is no exception and currently identified gene targets have been among those involved in cell cycle regulation and cell signalling, and thus necessary during all stages of mammalian development and essential for the proliferation of cells. miRNAs can be oncogenes or tumor suppressor genes depending on their targets while mir-92 has been implicated as the former in leukaemia forms AML and ALL, Hepatocellular carcinoma (HCC) and several other cancers. The search for non invasive tools for diagnosis and management of cancer is extremely important for reducing the world wide health burden of cancer. miRNAs show potential as biomarkers and can even be found circulating in the serum. Some circulating miRNAs are specific to tumour patients, while miR-92 on the other-hand is present in healthy individuals in the serum but levels are variable and appear to change in response to the onset of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uccuacggg         g       uu           uucaa 
5'          cagggaggu ugggaug  gugcaguguug     u
            ||||||||| |||||||  |||||||||||     c
3'          gucccuccg gcccugc  cacguuauaac     u
   -------ca         -       -u           cgccc 
Get sequence
Deep sequencing
1221 reads, 112 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
16: 45736481-45736562 [+]
sense
OTTDART00000059956 ; si:dkey-181d19.6-001; intron 1
OTTDART00000059957 ; si:dkey-181d19.6-002; exon 1
ENSDART00000156767 ; si:dkey-181d19.6-001; intron 1
ENSDART00000153501 ; si:dkey-181d19.6-002; exon 1
Database links

Mature sequence dre-miR-92b-5p

Accession MIMAT0031955
Sequence

15 - 

aggugugggauguugugcaguguu

 - 38

Get sequence
Deep sequencing522 reads, 3 experiments
Evidence not experimental

Mature sequence dre-miR-92b-3p

Accession MIMAT0001809
Previous IDsdre-miR-92b
Sequence

56 - 

uauugcacucgucccggccucc

 - 77

Get sequence
Deep sequencing511 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).