Stem-loop sequence dre-mir-93

AccessionMI0001954 (change log)
DescriptionDanio rerio miR-93 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
            -aa           g     g   u ug 
5' guguguguu   aagugcuguuu ugcag uag g  u
   |||||||||   ||||||||||| ||||| ||| |   
3' cacacacaa   uucacgacgag auguc auc c  u
            cac           g     -   u cu 
Get sequence
Deep sequencing
45812 reads, 1.61e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 100502-100575 [+]
sense
ENSDART00000051890 ; mcm7-201; intron 13
Clustered miRNAs
< 10kb from dre-mir-93
dre-mir-93chr14: 100502-100575 [+]
dre-mir-19dchr14: 100660-100746 [+]
dre-mir-25chr14: 100767-100848 [+]
Database links

Mature sequence dre-miR-93

Accession MIMAT0001810
Sequence

10 - 

aaaagugcuguuugugcaggua

 - 31

Get sequence
Deep sequencing45493 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).