Stem-loop sequence dre-mir-96

Accession MI0001955
Description Danio rerio miR-96 stem-loop
Gene family MIPF0000072; mir-96
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-96_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-96 microRNA precursor is a small non-coding RNA that regulates gene expression. microRNAs are transcribed as ~80 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~23 nucleotide products. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. These microRNAs are expressed specifically in the inner ear and the adult eye. miR-96 is thought to be conserved within Nephrozoa, i.e. the Deuterostomes and Protostomes. Variation within the seed region of mature miR-96 has been associated with autosomal dominant, progressive hearing loss in humans and mice. The homozygous mutant mice were profoundly deaf, showing no cochlear responses. Heterozygous mice and humans progressively lose the ability to hear. Five genes, of 132 predicted targets, have been experimentally validated as targets of miR-96: Aqp5, Celsr2, Myrip, Odf2 and Ryk. Microarray analysis of 4-day old wildtype and mutant mice showed that in the 3' UTR of upregulated genes, there was a significant enrichment in heptamers complementary to miR-96, implying that miR-96 normally affects a wide range of target genes, and that the mutation results in a loss of normal targets. Among the downregulated genes, there is a significant enrichment in heptamers complementary to the mutant miR-96, so the mutant miR-96 has gained novel targets. Among the downregulated genes were five of particular interest; Ocm, Pitpnm1, Prestin, Ptprq and Gfi1, all of which are strongly and specifically expressed in hair cells. Mice mutant for the latter three exhibit deafness and hair cell degeneration. A multiple sequence alignment of precursor miR-96 molecules. Highly conserved nucleotides are coloured in red, less well conserved nucleotides are coloured orange and non-conserved nucleotides are coloured blue or white. The columns corresponding to the mature and seed sequence are indicated above the alignment. The canonical human sequence and the two human variant sequences that are implicated in hearing loss (13G>A and 14C>A) are in the first, second and third rows respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    ---------------    -c   -    ug     u         g     uu      uuuuau 
gcug               ggcg  ucu ucuu  ccugu uuggcacua cacau  uugcuu      a
||||               ||||  ||| ||||  ||||| ||||||||| |||||  ||||||      u
cgac               ucgu  aga agaa  gggua aaccgugau gugua  aacgag      a
    uaaaaaaaaaauuca    ac   c    ca     u         -     uu      uuccau 
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 14140107-14140231 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-96
dre-mir-183 4: 14139958-14140055 [+]
dre-mir-96 4: 14140107-14140231 [+]
dre-mir-182 4: 14141057-14141124 [+]
Database links

Mature sequence dre-miR-96

Accession MIMAT0001811
Sequence

24 - 

uuuggcacuagcacauuuuugcu

 - 46

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).