Stem-loop sequence dre-mir-99-1

AccessionMI0001956
DescriptionDanio rerio miR-99-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        -uu u  uua         uc   u      aua gu 
5' gccac   g ca   acccguaga  cga cuugug   a  u
   |||||   | ||   |||||||||  ||| ||||||   |   
3' uggug   c gu   uggguaucu  gcu gaacac   u  u
        ucu u  cuc         ua   c      -gg ag 
Get sequence
Deep sequencing
3088 reads, 1.43e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 29144677-29144760 [+]
sense
OTTDART00000057551 ; zgc:153372-001; intron 10
ENSDART00000099958 ; zgc:153372-001; intron 10
Clustered miRNAs
< 10kb from dre-mir-99-1
dre-mir-99-115: 29144677-29144760 [+]
dre-let-7c-115: 29144917-29145023 [+]
dre-mir-125c15: 29150062-29150146 [+]
Database links

Mature sequence dre-miR-99

Accession MIMAT0001812
Sequence

14 - 

aacccguagauccgaucuugug

 - 35

Get sequence
Deep sequencing3360 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).