Stem-loop sequence dre-mir-99-2

AccessionMI0001957 (change log)
DescriptionDanio rerio miR-99-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention dre-mir-99-2
(4 sentences)

Stem-loop
      uu  c   --a         uc   u    ---  g  u 
5' cac  gu aca   acccguaga  cga cuug   ug cg a
   |||  || |||   |||||||||  ||| ||||   || ||  
3' gug  ca ugu   ugggugucu  gcu gaac   ac gc a
      -u  c   cuc         ua   c    cca  g  u 
Get sequence
Deep sequencing
72852 reads, 5.51e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 38074312-38074391 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-99-2
dre-mir-99-2chr10: 38074312-38074391 [-]
dre-let-7c-2chr10: 38072077-38072168 [-]
Database links

Mature sequence dre-miR-99

Accession MIMAT0001812
Sequence

12 - 

aacccguagauccgaucuugug

 - 33

Get sequence
Deep sequencing145856 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).