Stem-loop sequence dre-mir-100-1

AccessionMI0001958
DescriptionDanio rerio miR-100-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
       agaccu   -   u    c a   cg     c   a      g  ac 
5' gaag      gcc ugc gaca a acc  uagau cga cuugug ug  u
   ||||      ||| ||| |||| | |||  ||||| ||| |||||| ||   
3' cuuc      cgg gug cugu u ugg  aucua guu gaacac ac  g
       ------   u   u    c a   au     u   c      -  cu 
Get sequence
Deep sequencing
1405 reads, 438 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 20399275-20399370 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-100-1
dre-mir-100-115: 20399275-20399370 [+]
dre-let-7a-215: 20399518-20399601 [+]
Database links

Mature sequence dre-miR-100-5p

Accession MIMAT0001813
Previous IDsdre-miR-100
Sequence

24 - 

aacccguagauccgaacuugug

 - 45

Get sequence
Deep sequencing5779 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-100-3p

Accession MIMAT0031957
Sequence

59 - 

caagcuuguaucuauagguauc

 - 80

Get sequence
Deep sequencing42 reads, 1 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).