Stem-loop sequence dre-mir-100-2

AccessionMI0001959 (change log)
DescriptionDanio rerio miR-100-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

5 open access papers mention dre-mir-100-2
(9 sentences)

Stem-loop
   a  u c    a   cg    uc   a      gugu 
5'  gc g caca acc  uaga  cga cuugug    c
    || | |||| |||  ||||  ||| ||||||    u
3'  cg c gugu ugg  aucu  gcu gaacac    c
   g  u u    a   au    gu   c      gugu 
Get sequence
Deep sequencing
83022 reads, 5.98e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 29990147-29990221 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-100-2
dre-mir-100-2chr5: 29990147-29990221 [+]
dre-let-7a-4chr5: 29990452-29990544 [+]
dre-mir-125b-2chr5: 29998762-29998847 [+]
Database links

Mature sequence dre-miR-100-5p

Accession MIMAT0001813
Previous IDsdre-miR-100
Sequence

11 - 

aacccguagauccgaacuugug

 - 32

Get sequence
Deep sequencing163841 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-100-2-3p

Accession MIMAT0031958
Sequence

46 - 

caagcucgugucuauagguaug

 - 67

Get sequence
Deep sequencing1100 reads, 10 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).