Stem-loop sequence dre-mir-100-2

AccessionMI0001959
DescriptionDanio rerio miR-100-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   a  u c    a   cg    uc   a      gugu 
5'  gc g caca acc  uaga  cga cuugug    c
    || | |||| |||  ||||  ||| ||||||    u
3'  cg c gugu ugg  aucu  gcu gaacac    c
   g  u u    a   au    gu   c      gugu 
Get sequence
Deep sequencing
6337 reads, 2.08e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 31628637-31628711 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-100-2
dre-mir-100-25: 31628637-31628711 [+]
dre-let-7a-45: 31628942-31629034 [+]
dre-mir-125b-25: 31637252-31637337 [+]
Database links

Mature sequence dre-miR-100-5p

Accession MIMAT0001813
Previous IDsdre-miR-100
Sequence

11 - 

aacccguagauccgaacuugug

 - 32

Get sequence
Deep sequencing5779 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-100-2-3p

Accession MIMAT0031958
Sequence

46 - 

caagcucgugucuauagguaug

 - 67

Get sequence
Deep sequencing238 reads, 4 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).