Stem-loop sequence dre-mir-103

AccessionMI0001962 (change log)
DescriptionDanio rerio miR-103 stem-loop
Gene family MIPF0000024; mir-103
Literature search

3 open access papers mention dre-mir-103
(7 sentences)

Stem-loop
   uu    u     g   --   u  u           c   uggaa 
5'   gccc ggucu uca  gcc cu uacggugcugc uug     u
     |||| ||||| |||  ||| || ||||||||||| |||      
3'   cggg ccaga agu  cgg ga auguuacgacg aac     c
   cc    c     g   au   -  c           -   uaggu 
Get sequence
Deep sequencing
29291 reads, 1.02e+03 reads per million, 11 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr13: 15223296-15223383 [+]
sense
OTTDART00000037613 ; pank2-001; intron 5
ENSDART00000133041 ; pank2-001; intron 5
Database links

Mature sequence dre-miR-103

Accession MIMAT0001816
Sequence

53 - 

agcagcauuguacagggcuauga

 - 75

Get sequence
Deep sequencing29289 reads, 11 experiments
Evidence by similarity; MI0000108
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).