Stem-loop sequence dre-mir-107a

AccessionMI0001963 (change log)
Previous IDsdre-mir-107-1;dre-mir-107
DescriptionDanio rerio miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

5 open access papers mention dre-mir-107a
(11 sentences)

Stem-loop
   -----  u       c   --   u  u          u    ugg a 
5'      uc gugugcu uga  gcu cu uacaguguug cuug   c u
        || ||||||| |||  ||| || |||||||||| ||||   | g
3'      ag cacacga acu  cgg ga auguuacgac gaac   g g
   cgaca  u       c   au   -  c          -    -ua a 
Get sequence
Deep sequencing
30124 reads, 1.03e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr12: 16960693-16960781 [+]
sense
OTTDART00000036913 ; pank1b-001; intron 5
ENSDART00000020824 ; pank1b-001; intron 5
Database links

Mature sequence dre-miR-107a-5p

Accession MIMAT0031959
Sequence

14 - 

agcuucuuuacaguguugucuug

 - 36

Get sequence
Deep sequencing477 reads, 10 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-107a-3p

Accession MIMAT0001817
Previous IDsdre-miR-107a
Sequence

51 - 

agcagcauuguacagggcuauca

 - 73

Get sequence
Deep sequencing29647 reads, 11 experiments
Evidence by similarity; MI0000114
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).