Stem-loop sequence dre-mir-122

AccessionMI0001965 (change log)
DescriptionDanio rerio miR-122 stem-loop
Gene family MIPF0000095; mir-122
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-122. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-122 is a miRNA that is conserved between vertebrate species. miR-122 is not present in invertebrates, and no close paralogs of miR-122 have been detected. miR-122 expression is specific to the liver, where it has been implicated as a regulator of fatty-acid metabolism in mouse studies. Reduced miR-122 levels are associated with hepatocellular carcinoma. miR-122 also plays an important positive role in the regulation of hepatitis C virus replication.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ucca a     gg       c           -uau a 
5'     g gcugu  aguguga aaugguguuug    c u
       | |||||  ||||||| |||||||||||    |  
3'     c cgaua  ucacacu uuaccgcaaac    g c
   ggca -     aa       a           ugcu u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr21: 10881423-10881498 [-]
intergenic
Database links

Mature sequence dre-miR-122

Accession MIMAT0001818
Sequence

11 - 

uggagugugacaaugguguuug

 - 32

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).