Stem-loop sequence dre-mir-122

AccessionMI0001965 (change log)
DescriptionDanio rerio miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

15 open access papers mention dre-mir-122
(71 sentences)

Stem-loop
   ucca a     gg       c           -uau a 
5'     g gcugu  aguguga aaugguguuug    c u
       | |||||  ||||||| |||||||||||    |  
3'     c cgaua  ucacacu uuaccgcaaac    g c
   ggca -     aa       a           ugcu u 
Get sequence
Deep sequencing
2695 reads, 75 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr21: 10881423-10881498 [-]
intergenic
Database links

Mature sequence dre-miR-122

Accession MIMAT0001818
Sequence

11 - 

uggagugugacaaugguguuug

 - 32

Get sequence
Deep sequencing2695 reads, 8 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).