Stem-loop sequence dre-mir-124-1

AccessionMI0001966 (change log)
DescriptionDanio rerio miR-124-1 stem-loop
Gene family MIPF0000021; mir-124
Literature search

23 open access papers mention dre-mir-124-1
(78 sentences)

Stem-loop
       cuc     ac        a   ga        uauu 
5' ggcu   gcugu  guguucac gug  ccuugauu    g
   ||||   |||||  |||||||| |||  ||||||||    u
3' ccga   cgaca  cguaagug cgc  ggaauuaa    a
       -ca     ac        g   ac        cuuu 
Get sequence
Deep sequencing
8135 reads, 262 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 26645317-26645398 [-]
intergenic
Database links

Mature sequence dre-miR-124-3p

Accession MIMAT0001819
Previous IDsdre-miR-124
Sequence

51 - 

uaaggcacgcggugaaugccaa

 - 72

Get sequence
Deep sequencing29486 reads, 8 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).