Stem-loop sequence dre-mir-124-4

AccessionMI0001969 (change log)
DescriptionDanio rerio miR-124-4 stem-loop
Gene family MIPF0000021; mir-124
Literature search

23 open access papers mention dre-mir-124-4
(78 sentences)

Stem-loop
          g     u        a   ga        uaauu 
5' gguuuuu cucuu guguucac gug  ccuugauu     u
   ||||||| ||||| |||||||| |||  ||||||||      
3' ccgaaga gagaa cguaagug cgc  ggaauuaa     c
          -     c        g   ac        cauaa 
Get sequence
Deep sequencing
5122 reads, 138 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr17: 27402261-27402343 [+]
intergenic
Database links

Mature sequence dre-miR-124-4-5p

Accession MIMAT0031961
Sequence

14 - 

uguguucacaguggaccuugau

 - 35

Get sequence
Deep sequencing207 reads, 5 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-124-3p

Accession MIMAT0001819
Previous IDsdre-miR-124
Sequence

52 - 

uaaggcacgcggugaaugccaa

 - 73

Get sequence
Deep sequencing29486 reads, 8 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).