Stem-loop sequence dre-mir-124-5

Accession

MI0001970

Description

Danio rerio miR-124-5 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Stem-loop

   gg  uuu      -  guucuuuuu   -    cg    - c        a   ga        uaaug 
5'   gu   gcucgu gc         gag uucu  cucu g guguucac gcg  ccuugauu     u
     ||   |||||| ||         ||| ||||  |||| | |||||||| |||  ||||||||      
3'   cg   ugagca cg         cuc aaga  gaga c cguaagug cgc  ggaauuaa     c
   cg  -uu      a  -----accu   u    -a    a -        g   ac        cauac 

Deep sequencing

421 reads, 35.4 reads per million, 4 experiments

Confidence

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Zv9): 23: 17954131-17954259 [+]
• Overlapping transcripts:

  antisense

  OTTDART00000059682 ; si:ch211-280c4.5-001; intron 2

  ENSDART00000155348 ; si:ch211-280c4.5-001; intron 2

Database links

• MIRBASE-TRACKER:MI0001970
• ENTREZGENE: 100033632;mir124-5
• ENTREZGENE: 100628858;mir124-5
• RNACENTRAL:URS000075D521/7955

Mature sequence dre-miR-124-5p

• Accession: MIMAT0031960
• Sequence: 39 - cguguucacagcggaccuugau - 60
• Deep sequencing: 2971 reads, 4 experiments
• Evidence: not experimental

Mature sequence dre-miR-124-3p

• Accession: MIMAT0001819
• Previous IDs: dre-miR-124
• Sequence: 77 - uaaggcacgcggugaaugccaa - 98
• Deep sequencing: 4104 reads, 4 experiments
• Evidence: experimental; cloned [1]

References

1. PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).