Stem-loop sequence dre-mir-124-5

AccessionMI0001970 (change log)
DescriptionDanio rerio miR-124-5 stem-loop
Gene family MIPF0000021; mir-124
Literature search

23 open access papers mention dre-mir-124-5
(78 sentences)

Stem-loop
   gg  uuu      -  guucuuuuu   -    cg    - c        a   ga        uaaug 
5'   gu   gcucgu gc         gag uucu  cucu g guguucac gcg  ccuugauu     u
     ||   |||||| ||         ||| ||||  |||| | |||||||| |||  ||||||||      
3'   cg   ugagca cg         cuc aaga  gaga c cguaagug cgc  ggaauuaa     c
   cg  -uu      a  -----accu   u    -a    a -        g   ac        cauac 
Get sequence
Deep sequencing
8545 reads, 275 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 17783413-17783541 [+]
antisense
OTTDART00000059682 ; si:ch211-280c4.5-001; intron 2
ENSDART00000155348 ; si:ch211-280c4.5-001; intron 2
Database links

Mature sequence dre-miR-124-5p

Accession MIMAT0031960
Sequence

39 - 

cguguucacagcggaccuugau

 - 60

Get sequence
Deep sequencing10884 reads, 5 experiments
Evidence not experimental

Mature sequence dre-miR-124-3p

Accession MIMAT0001819
Previous IDsdre-miR-124
Sequence

77 - 

uaaggcacgcggugaaugccaa

 - 98

Get sequence
Deep sequencing29486 reads, 8 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).