Stem-loop sequence dre-mir-124-6

AccessionMI0001971
DescriptionDanio rerio miR-124-6 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ---ggguggugacac      g ca    - c        g   ga        uaaua 
5'                aggccc c  cucu g guguucac gcg  ccuugauu     u
                  |||||| |  |||| | |||||||| |||  ||||||||      
3'                ucuggg g  gaga c cguaagug cgc  ggaauuaa     c
   cccaaacagcaaaau      - -a    a -        g   ac        cauac 
Get sequence
Deep sequencing
462 reads, 46 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
8: 23975705-23975817 [-]
intergenic
Database links

Mature sequence dre-miR-124-6-5p

Accession MIMAT0031962
Sequence

28 - 

cguguucacggcggaccuugau

 - 49

Get sequence
Deep sequencing284 reads, 3 experiments
Evidence not experimental

Mature sequence dre-miR-124-3p

Accession MIMAT0001819
Previous IDsdre-miR-124
Sequence

66 - 

uaaggcacgcggugaaugccaa

 - 87

Get sequence
Deep sequencing4104 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).