Stem-loop sequence dre-mir-125a-1

AccessionMI0001972
DescriptionDanio rerio miR-125a-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
         cu      c      ac     a       ---  u 
5' guaugu  cuuugu ccugag  ccuua ccuguga   gg c
   ||||||  |||||| ||||||  ||||| |||||||   || a
3' cguacg  gggaca ggacuc  ggagu ggacacu   uc a
         uc      a      cu     -       gga  a 
Get sequence
Deep sequencing
142 reads, 34.4 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
16: 27137452-27137534 [+]
intergenic
Database links

Mature sequence dre-miR-125a

Accession MIMAT0001820
Sequence

14 - 

ucccugagacccuuaaccugug

 - 35

Get sequence
Deep sequencing115 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).