Stem-loop sequence dre-mir-125a-1

AccessionMI0001972 (change log)
DescriptionDanio rerio miR-125a-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
         cu      c      ac     a       ---  u 
5' guaugu  cuuugu ccugag  ccuua ccuguga   gg c
   ||||||  |||||| ||||||  ||||| |||||||   || a
3' cguacg  gggaca ggacuc  ggagu ggacacu   uc a
         uc      a      cu     -       gga  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 24898171-24898253 [+]
intergenic
Database links

Mature sequence dre-miR-125a

Accession MIMAT0001820
Sequence

14 - 

ucccugagacccuuaaccugug

 - 35

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).