Stem-loop sequence dre-mir-125a-2

AccessionMI0001973
DescriptionDanio rerio miR-125a-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   gauca   caa   g       u      c  ug  ac     a        g cu 
5'      guc   auc auguaug cugugu cc  ag  ccuua ccugugau u  u
        |||   ||| ||||||| |||||| ||  ||  ||||| |||||||| |   
3'      cag   uag uauaugu ggcaca gg  uc  ggagu ggacacug a  c
   --cug   ---   -       c      a  gu  cu     -        g ac 
Get sequence
Deep sequencing
32 reads, 13.5 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
19: 10066308-10066414 [+]
intergenic
Database links

Mature sequence dre-miR-125a

Accession MIMAT0001820
Sequence

29 - 

ucccugagacccuuaaccugug

 - 50

Get sequence
Deep sequencing115 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).