Stem-loop sequence dre-mir-125a-2

AccessionMI0001973 (change log)
DescriptionDanio rerio miR-125a-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   gauca   caa   g       u      c  ug  ac     a        g cu 
5'      guc   auc auguaug cugugu cc  ag  ccuua ccugugau u  u
        |||   ||| ||||||| |||||| ||  ||  ||||| |||||||| |   
3'      cag   uag uauaugu ggcaca gg  uc  ggagu ggacacug a  c
   --cug   ---   -       c      a  gu  cu     -        g ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr19: 9443772-9443878 [+]
intergenic
Database links

Mature sequence dre-miR-125a

Accession MIMAT0001820
Sequence

29 - 

ucccugagacccuuaaccugug

 - 50

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).