Stem-loop sequence dre-mir-125b-1

AccessionMI0001975
DescriptionDanio rerio miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u    uugc g        -     cu   aau ug      a  -a    u    c           -    uuu 
5'  ucug    a guuggcgg uuggu  gca   g  ccucuc ca  uccc gaga ccuaacuugug acgu   c
    ||||    | |||||||| |||||  |||   |  |||||| ||  |||| |||| ||||||||||| ||||   c
3'  aggc    u cggccgcc gacua  ugu   c  ggggag gu  aggg uucu ggauugggcac ugua   u
   a    ---- g        c     -c   -cu gu      a  cg    -    u           g    uug 
Get sequence
Deep sequencing
468 reads, 91.5 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 20409298-20409442 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-125b-1
dre-let-7a-215: 20399518-20399601 [+]
dre-mir-125b-115: 20409298-20409442 [+]
Database links

Mature sequence dre-miR-125b-5p

Accession MIMAT0001821
Previous IDsdre-miR-125b
Sequence

46 - 

ucccugagacccuaacuuguga

 - 67

Get sequence
Deep sequencing1654 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

Mature sequence dre-miR-125b-1-3p

Accession MIMAT0031963
Sequence

86 - 

acggguuagguucuugggagcu

 - 107

Get sequence
Deep sequencing245 reads, 3 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).