Stem-loop sequence dre-mir-125b-2

AccessionMI0001976
DescriptionDanio rerio miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        c   u -c     u    c           -     cu 
5' gugcc cuc c  uuccc gaga ccuaacuugug acguu  g
   ||||| ||| |  ||||| |||| ||||||||||| |||||  c
3' cacgg gag g  gaggg cucu ggguugggcac uguag  u
        a   u uc     -    u           c     cu 
Get sequence
Deep sequencing
1769 reads, 641 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 31637252-31637337 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-125b-2
dre-mir-100-25: 31628637-31628711 [+]
dre-let-7a-45: 31628942-31629034 [+]
dre-mir-125b-25: 31637252-31637337 [+]
Database links

Mature sequence dre-miR-125b-5p

Accession MIMAT0001821
Previous IDsdre-miR-125b
Sequence

14 - 

ucccugagacccuaacuuguga

 - 35

Get sequence
Deep sequencing1654 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

Mature sequence dre-miR-125b-2-3p

Accession MIMAT0031964
Sequence

55 - 

cggguuggguucucgggagcu

 - 75

Get sequence
Deep sequencing76 reads, 4 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).