Stem-loop sequence dre-mir-125b-2

AccessionMI0001976 (change log)
DescriptionDanio rerio miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        c   u -c     u    c           -     cu 
5' gugcc cuc c  uuccc gaga ccuaacuugug acguu  g
   ||||| ||| |  ||||| |||| ||||||||||| |||||  c
3' cacgg gag g  gaggg cucu ggguugggcac uguag  u
        a   u uc     -    u           c     cu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 29998762-29998847 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-125b-2
dre-mir-100-2chr5: 29990147-29990221 [+]
dre-let-7a-4chr5: 29990452-29990544 [+]
dre-mir-125b-2chr5: 29998762-29998847 [+]
Database links

Mature sequence dre-miR-125b-5p

Accession MIMAT0001821
Previous IDsdre-miR-125b
Sequence

14 - 

ucccugagacccuaacuuguga

 - 35

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-125b-2-3p

Accession MIMAT0031964
Sequence

55 - 

cggguuggguucucgggagcu

 - 75

Get sequence
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).