Stem-loop sequence dre-mir-125b-3

AccessionMI0001977 (change log)
DescriptionDanio rerio miR-125b-3 stem-loop
Gene family MIPF0000033; mir-10
Literature search

24 open access papers mention dre-mir-125b-3
(186 sentences)

Stem-loop
     c    ---g   accg    acuccu  u      u    c c          gc    u 
5' cc gugc    gcc    cugc      cc gguccc gaga c uaacuuguga  uuug g
   || ||||    |||    ||||      || |||||| |||| | ||||||||||  |||| u
3' gg cacg    cgg    gacg      gg ccaggg uucu g auuggacacu  aaau g
     u    aaaa   --ga    ------  u      -    c a          aa    c 
Get sequence
Deep sequencing
21169 reads, 1.32e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 38051652-38051766 [-]
intergenic
Database links

Mature sequence dre-miR-125b-5p

Accession MIMAT0001821
Previous IDsdre-miR-125b
Sequence

31 - 

ucccugagacccuaacuuguga

 - 52

Get sequence
Deep sequencing62216 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-125b-3-3p

Accession MIMAT0031965
Sequence

72 - 

acagguuaagcucuugggaccu

 - 93

Get sequence
Deep sequencing417 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).