Stem-loop sequence dre-mir-125c

AccessionMI0001978
DescriptionDanio rerio miR-125c stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
          u     uc  ug  ac   a        ----  uc 
5' gcucucc ccugu  cc  ag  ccu acucguga    gg  u
   ||||||| |||||  ||  ||  ||| ||||||||    ||  u
3' cgggagg ggaca  gg  uc  gga ugggcacu    cc  u
          u     ga  gu  ga   c        aaaa  uu 
Get sequence
Deep sequencing
405 reads, 68.8 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 29150062-29150146 [+]
sense
OTTDART00000057551 ; zgc:153372-001; intron 10
ENSDART00000099958 ; zgc:153372-001; intron 10
Clustered miRNAs
< 10kb from dre-mir-125c
dre-mir-99-115: 29144677-29144760 [+]
dre-let-7c-115: 29144917-29145023 [+]
dre-mir-125c15: 29150062-29150146 [+]
Database links

Mature sequence dre-miR-125c-5p

Accession MIMAT0001822
Previous IDsdre-miR-125c
Sequence

14 - 

ucccugagacccuaacucguga

 - 35

Get sequence
Deep sequencing255 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-125c-3p

Accession MIMAT0031966
Sequence

53 - 

acgggucaggagcuugggagac

 - 74

Get sequence
Deep sequencing99 reads, 4 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).