Stem-loop sequence dre-mir-126a

AccessionMI0001979 (change log)
Previous IDsdre-mir-126
DescriptionDanio rerio miR-126a stem-loop
Gene family MIPF0000115; mir-126
Literature search

15 open access papers mention dre-mir-126a
(62 sentences)

Stem-loop
        auuuua     uu      c           u       c --cu  gc 
5' gagcc      acugc  cacagu cauuauuacuu ugguacg g    ag  c
   |||||      |||||  |||||| ||||||||||| ||||||| |    ||   
3' uuugg      ugacg  guguca guaauaaugag gccaugc c    uc  a
        -----g     --      c           u       u aaac  ag 
Get sequence
Deep sequencing
24643 reads, 4.25e+04 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 11548419-11548519 [-]
sense
OTTDART00000034875 ; si:ch211-248e11.2-002; intron 1
OTTDART00000034876 ; si:ch211-248e11.2-003; exon 2
ENSDART00000133932 ; C8H9orf116-002; intron 1
ENSDART00000148217 ; C8H9orf116-003; exon 2
Database links

Mature sequence dre-miR-126a-5p

Accession MIMAT0003157
Previous IDsdre-miR-126*;dre-miR-126a*
Sequence

26 - 

cauuauuacuuuugguacgcg

 - 46

Get sequence
Deep sequencing10228 reads, 11 experiments
Evidence experimental; array [2]
Database links

Mature sequence dre-miR-126a-3p

Accession MIMAT0001823
Previous IDsdre-miR-126;dre-miR-126a
Sequence

64 - 

ucguaccgugaguaauaaugc

 - 84

Get sequence
Deep sequencing14405 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).