Stem-loop sequence dre-mir-126a

AccessionMI0001979 (change log)
Previous IDsdre-mir-126
DescriptionDanio rerio miR-126a stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        auuuua     uu      c           u       c --cu  gc 
5' gagcc      acugc  cacagu cauuauuacuu ugguacg g    ag  c
   |||||      |||||  |||||| ||||||||||| ||||||| |    ||   
3' uuugg      ugacg  guguca guaauaaugag gccaugc c    uc  a
        -----g     --      c           u       u aaac  ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 11548419-11548519 [-]
sense
OTTDART00000034875 ; si:ch211-248e11.2-002; intron 1
OTTDART00000034876 ; si:ch211-248e11.2-003; exon 2
ENSDART00000133932 ; C8H9orf116-002; intron 1
ENSDART00000148217 ; C8H9orf116-003; exon 2
Database links

Mature sequence dre-miR-126a-5p

Accession MIMAT0003157
Previous IDsdre-miR-126*;dre-miR-126a*
Sequence

26 - 

cauuauuacuuuugguacgcg

 - 46

Get sequence
Evidence experimental; array [2]
Database links

Mature sequence dre-miR-126a-3p

Accession MIMAT0001823
Previous IDsdre-miR-126;dre-miR-126a
Sequence

64 - 

ucguaccgugaguaauaaugc

 - 84

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).