Stem-loop sequence dre-mir-126a

AccessionMI0001979
Previous IDsdre-mir-126
DescriptionDanio rerio miR-126a stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        auuuua     uu      c           u       c --cu  gc 
5' gagcc      acugc  cacagu cauuauuacuu ugguacg g    ag  c
   |||||      |||||  |||||| ||||||||||| ||||||| |    ||   
3' uuugg      ugacg  guguca guaauaaugag gccaugc c    uc  a
        -----g     --      c           u       u aaac  ag 
Get sequence
Deep sequencing
4629 reads, 502 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
8: 12065951-12066051 [-]
sense
OTTDART00000034875 ; si:ch211-248e11.2-002; intron 1
OTTDART00000034876 ; si:ch211-248e11.2-003; exon 2
ENSDART00000133932 ; C8H9orf116-002; intron 1
ENSDART00000148217 ; C8H9orf116-003; exon 2
Database links

Mature sequence dre-miR-126a-5p

Accession MIMAT0003157
Previous IDsdre-miR-126*;dre-miR-126a*
Sequence

26 - 

cauuauuacuuuugguacgcg

 - 46

Get sequence
Deep sequencing37 reads, 3 experiments
Evidence experimental; array [2]

Mature sequence dre-miR-126a-3p

Accession MIMAT0001823
Previous IDsdre-miR-126;dre-miR-126a
Sequence

64 - 

ucguaccgugaguaauaaugc

 - 84

Get sequence
Deep sequencing3985 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).