Stem-loop sequence dre-mir-128-1

AccessionMI0001980
DescriptionDanio rerio miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u ga  ag   u         c       ugg      au    uu a 
5'  g  gg  gag gcugggaga ggggccg   cacugu  gaga  c u
    |  ||  ||| ||||||||| |||||||   ||||||  ||||  | g
3'  c  uc  cuc cgaccuuuu cucuggc   gugaca  cuuu  g u
   a ag  -a   c         u       caa      cu    cg a 
Get sequence
Deep sequencing
370 reads, 40.6 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
22: 12504146-12504243 [+]
sense
OTTDART00000035435 ; r3hdm1-001; intron 5
ENSDART00000146322 ; r3hdm1-001; intron 5
ENSDART00000091982 ; r3hdm1-201; intron 14
Database links

Mature sequence dre-miR-128-5p

Accession MIMAT0031967
Sequence

22 - 

cggggccguggcacuguaugaga

 - 44

Get sequence
Deep sequencing61 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-128-3p

Accession MIMAT0001824
Previous IDsdre-miR-128
Sequence

60 - 

ucacagugaaccggucucuuuu

 - 81

Get sequence
Deep sequencing2392 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).