Stem-loop sequence dre-mir-128-2

AccessionMI0001981
DescriptionDanio rerio miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
             ----g  --cu  c          c         u   u     ca      cug 
5' ucugcucaug     gu    gu aguaguagga agggggccg uuc acugu  gagaug   c
   ||||||||||     ||    || |||||||||| ||||||||| ||| |||||  ||||||    
3' agacgaguau     cg    ca uuaucguccu uucucuggc aag ugaca  cucugc   c
             aauaa  ucuu  c          u         c   -     --      uca 
Get sequence
Deep sequencing
2358 reads, 263 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
19: 44518214-44518336 [+]
sense
OTTDART00000040158 ; arpp21-001; intron 18
ENSDART00000051724 ; arpp21-201; intron 17
ENSDART00000151298 ; arpp21-001; intron 18
Database links

Mature sequence dre-miR-128-3p

Accession MIMAT0001824
Previous IDsdre-miR-128
Sequence

69 - 

ucacagugaaccggucucuuuu

 - 90

Get sequence
Deep sequencing2392 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).