Stem-loop sequence dre-mir-130b

AccessionMI0001986
DescriptionDanio rerio miR-130b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cu  u c    ca       cc         -----a   ug   
5'   gu g cuga  cucuuuc  uguugcacu      cug  gg 
     || | ||||  |||||||  |||||||||      |||  | a
3'   ca c gacu  gggaaag  auaacguga      gac  cg 
   gu  c u    ac       ua         cgaaac   gu   
Get sequence
Deep sequencing
25951 reads, 2.56e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 14501677-14501760 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-130b
dre-mir-301b5: 14491699-14491779 [+]
dre-mir-454b5: 14498653-14498768 [+]
dre-mir-130b5: 14501677-14501760 [+]
Database links

Mature sequence dre-miR-130b

Accession MIMAT0001827
Sequence

53 - 

cagugcaauaaugaaagggcau

 - 74

Get sequence
Deep sequencing22395 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).