Stem-loop sequence dre-mir-130c-1

AccessionMI0001987
DescriptionDanio rerio miR-130c-1 stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
           uc  uac     uauu   ca        ---   u         uc         a  ggcca 
5' gggagagg  ug   gguga    gac  uguuuugu   cca ugcccuuuu  uguuguacu cu     a
   ||||||||  ||   |||||    |||  ||||||||   ||| |||||||||  ||||||||| ||     u
3' uccucucc  ac   ccacu    cug  acaagaua   ggu acgggaaaa  auaacguga ga     c
           -c  ucu     --uc   ag        guc   u         uu         c  gaaga 
Get sequence
Deep sequencing
30079 reads, 3.17e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 17483583-17483723 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-130c-1
dre-mir-130c-110: 17483583-17483723 [+]
dre-mir-301c10: 17484710-17484792 [+]
Database links

Mature sequence dre-miR-130c-5p

Accession MIMAT0031969
Sequence

43 - 

gcccuuuuucuguuguacuacu

 - 64

Get sequence
Deep sequencing61 reads, 3 experiments
Evidence not experimental

Mature sequence dre-miR-130c-3p

Accession MIMAT0001828
Previous IDsdre-miR-130c
Sequence

80 - 

cagugcaauauuaaaagggcau

 - 101

Get sequence
Deep sequencing29209 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).