Stem-loop sequence dre-mir-132-1

AccessionMI0001989
DescriptionDanio rerio miR-132-1 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -   uc a             au             u    ac 
5'  guc  c uggcgaccguggc  uagauuguuacug agga  a
    |||  | |||||||||||||  ||||||||||||| ||||   
3'  cgg  g aucgcugguaccg  aucugacaauggu uuuu  g
   a   gu -             ac             -    aa 
Get sequence
Deep sequencing
14 reads, 2.91 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 25232522-25232606 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-132-1
dre-mir-21215: 25232253-25232346 [+]
dre-mir-132-115: 25232522-25232606 [+]
Database links

Mature sequence dre-miR-132-5p

Accession MIMAT0003403
Previous IDsdre-miR-132*
Sequence

13 - 

accguggcauuagauuguuacu

 - 34

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-132-3p

Accession MIMAT0001829
Previous IDsdre-miR-132
Sequence

54 - 

uaacagucuacagccauggucg

 - 75

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).