Stem-loop sequence dre-mir-133a-1

AccessionMI0001993 (change log)
DescriptionDanio rerio miR-133a-1 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
          ccacaau  uuu    a       aa  u  a        accuc 
5' caucaaa       gc   gcua agcuggu  aa gg accaaauc     u
   |||||||       ||   |||| |||||||  || || ||||||||      
3' guaguuu       cg   cgau ucgacca  uu cc ugguuuag     u
          -------  uau    g       ac  c  c        guaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 4114118-4114216 [-]
antisense
ENSDART00000077966 ; MIB1 (1 of 2)-201; intron 1
Clustered miRNAs
< 10kb from dre-mir-133a-1
dre-mir-1-2chr2: 4116314-4116400 [-]
dre-mir-133a-1chr2: 4114118-4114216 [-]
Database links

Mature sequence dre-miR-133a-5p

Accession MIMAT0003404
Previous IDsdre-miR-133a*
Sequence

25 - 

agcugguaaaauggaaccaaau

 - 46

Get sequence
Evidence experimental; cloned [1]
Database links

Mature sequence dre-miR-133a-3p

Accession MIMAT0001830
Previous IDsdre-miR-133a
Sequence

62 - 

uuugguccccuucaaccagcug

 - 83

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).