Stem-loop sequence dre-mir-133b

AccessionMI0001994
DescriptionDanio rerio miR-133b stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       ccu   u         ca  u  a     gu ag  gu 
5' cacg   ugc guggcuggu  aa gg accaa  c  gu  u
   ||||   ||| |||||||||  || || |||||  |  ||   
3' gugc   gcg caucgacca  uu cc ugguu  g  cg  u
       --u   u         ac  c  c     ug ag  uc 
Get sequence
Deep sequencing
4853 reads, 414 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
20: 19615539-19615622 [-]
sense
OTTDART00000058152 ; si:ch211-101l18.8-001; exon 2
ENSDART00000152763 ; si:ch211-101l18.8-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-133b
dre-mir-206-120: 19616808-19616906 [-]
dre-mir-133b20: 19615539-19615622 [-]
Database links

Mature sequence dre-miR-133b-5p

Accession MIMAT0003405
Previous IDsdre-miR-133b*
Sequence

15 - 

gcuggucaaauggaaccaaguc

 - 36

Get sequence
Deep sequencing2266 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-133b-3p

Accession MIMAT0001831
Previous IDsdre-miR-133b
Sequence

53 - 

uuugguccccuucaaccagcua

 - 74

Get sequence
Deep sequencing2016 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).