Stem-loop sequence dre-mir-135c-1

AccessionMI0001996
Previous IDsdre-mir-135-1
DescriptionDanio rerio miR-135c-1 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ug     uu u        cuau           uuucu 
5'   cugug  u auggcuuu    uccuaugugau     u
     |||||  | ||||||||    |||||||||||     c
3'   gacau  g uaccgaaa    gggauacacug     u
   ga     gg u        -cuu           ugccg 
Get sequence
Deep sequencing
126 reads, 34.4 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
11: 39340847-39340926 [-]
intergenic
Database links

Mature sequence dre-miR-135c

Accession MIMAT0001833
Previous IDsdre-miR-135
Sequence

11 - 

uauggcuuucuauuccuaugug

 - 32

Get sequence
Deep sequencing117 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).