Stem-loop sequence dre-mir-137-1

AccessionMI0002000
DescriptionDanio rerio miR-137-1 stem-loop
Gene family MIPF0000106; mir-137
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-137. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-137 (or microRNA-137) is a short non-coding RNA molecule that functions to regulate the expression levels of other genes by various mechanisms. miR-137 is located on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types including colorectal cancer, squamous cell carcinoma and melanoma via cell cycle control. Recent genome-wide association studies (GWAS) have provided evidence to suggest that single nucleotide polymorphisms in the vicinity of the MIR137 gene are statistically associated with schizophrenia and other psychiatric disorders. miR-137 is shown to regulate neural stem cell proliferation and differentiation in mouse embryonic stem cells, and neuronal maturation, including regulation of dendrite length, branch points, end points, and spine density in mouse adult hippocampal neuroprogenitor-derived and mouse fetal hippocampus neurons. Decreased spine density has also been observed in the dorsolateral cortex of patients with schizophrenia. miR-137 belongs to the miR-137 clan (a clan is group of two or more RNA families that have arisen from a single evolutionary origin, as derived from their related structure and function). The miR-137 clan contains two members: miR-137 and miR-234; the total number of RNA domains in the clan is 112.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
               ug   g           ug a     -  g 
5' ggcucucuucgg  acg guauucuuggg  g uaaua cg c
   ||||||||||||  ||| |||||||||||  | ||||| || u
3' cugagaggaguu  ugc cauaagaauuc  u auugu gc c
               ga   g           gu -     u  u 
Get sequence
Deep sequencing
796 reads, 75.1 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
2: 18658781-18658865 [-]
intergenic
Database links

Mature sequence dre-miR-137-5p

Accession MIMAT0031972
Sequence

15 - 

acggguauucuuggguggauaaua

 - 38

Get sequence
Deep sequencing551 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-137-3p

Accession MIMAT0001834
Previous IDsdre-miR-137
Sequence

51 - 

uuauugcuuaagaauacgcgua

 - 72

Get sequence
Deep sequencing2888 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).