Stem-loop sequence dre-mir-137-1

AccessionMI0002000 (change log)
DescriptionDanio rerio miR-137-1 stem-loop
Gene family MIPF0000106; mir-137
Literature search

6 open access papers mention dre-mir-137-1
(108 sentences)

Stem-loop
               ug   g           ug a     -  g 
5' ggcucucuucgg  acg guauucuuggg  g uaaua cg c
   ||||||||||||  ||| |||||||||||  | ||||| || u
3' cugagaggaguu  ugc cauaagaauuc  u auugu gc c
               ga   g           gu -     u  u 
Get sequence
Deep sequencing
3725 reads, 100 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 20145741-20145825 [-]
intergenic
Database links

Mature sequence dre-miR-137-5p

Accession MIMAT0031972
Sequence

15 - 

acggguauucuuggguggauaaua

 - 38

Get sequence
Deep sequencing1252 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-137-3p

Accession MIMAT0001834
Previous IDsdre-miR-137
Sequence

51 - 

uuauugcuuaagaauacgcgua

 - 72

Get sequence
Deep sequencing6196 reads, 9 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).