Stem-loop sequence dre-mir-138

AccessionMI0002002
DescriptionDanio rerio miR-138 stem-loop
Gene family MIPF0000075; mir-138
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-138. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-138 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-138 precursor is the microRNA mir-138. miR-138 has been used as an example of the post-transcriptional regulation of miRNA, due to the finding that while the precursor is expressed ubiquitously, the mature product is found only in specific cell types.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   -   ug ag             uca     --a    a ac 
5'  gug ugc  c  cugguguugugaa   ggccg   uguc c  g
    ||| |||  |  |||||||||||||   |||||   |||| |   
3'  cac acg  g  gaccacaacacuu   ucggc   auag g  u
   a   c   gu -g             -ua     cca    c ac 
Get sequence
Deep sequencing
7567 reads, 787 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
18: 17239327-17239413 [+]
intergenic
Database links

Mature sequence dre-miR-138-5p

Accession MIMAT0001835
Previous IDsdre-miR-138
Sequence

11 - 

agcugguguugugaaucaggcc

 - 32

Get sequence
Deep sequencing6443 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

Mature sequence dre-miR-138-3p

Accession MIMAT0031973
Sequence

58 - 

gcuauuucacaacaccagggu

 - 78

Get sequence
Deep sequencing161 reads, 4 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).