Stem-loop sequence dre-mir-138-1

AccessionMI0002002 (change log)
DescriptionDanio rerio miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Literature search

4 open access papers mention dre-mir-138-1
(9 sentences)

Stem-loop
   u   -   ug ag             uca     --a    a ac 
5'  gug ugc  c  cugguguugugaa   ggccg   uguc c  g
    ||| |||  |  |||||||||||||   |||||   |||| |   
3'  cac acg  g  gaccacaacacuu   ucggc   auag g  u
   a   c   gu -g             -ua     cca    c ac 
Get sequence
Deep sequencing
8122 reads, 1.21e+04 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr18: 17580159-17580245 [+]
intergenic
Database links

Mature sequence dre-miR-138-5p

Accession MIMAT0001835
Previous IDsdre-miR-138
Sequence

11 - 

agcugguguugugaaucaggccg

 - 33

Get sequence
Deep sequencing15786 reads, 12 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-138-3p

Accession MIMAT0031973
Sequence

58 - 

gcuauuucacaacaccagggu

 - 78

Get sequence
Deep sequencing217 reads, 4 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).