Stem-loop sequence dre-mir-140

AccessionMI0002003
DescriptionDanio rerio miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop
      uu gu    -u ug       a             a       uu   uc 
5' gug  u  cucc  g  ucccguc gugguuuuacccu ugguagg  acg  a
   |||  |  ||||  |  ||||||| ||||||||||||| |||||||  |||   
3' cgu  g  gagg  u  agggcag caccaagauggga accaucu  ugu  u
      cu ug    uc gu       g             c       --   cg 
Get sequence
Deep sequencing
1784 reads, 539 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
25: 35855072-35855176 [+]
sense
OTTDART00000038800 ; wwp2-001; intron 17
ENSDART00000087364 ; wwp2-201; intron 15
ENSDART00000136640 ; wwp2-001; intron 17
Database links

Mature sequence dre-miR-140-5p

Accession MIMAT0001836
Previous IDsdre-miR-140
Sequence

23 - 

cagugguuuuacccuaugguag

 - 44

Get sequence
Deep sequencing141 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

Mature sequence dre-miR-140-3p

Accession MIMAT0003159
Previous IDsdre-miR-140*
Sequence

62 - 

uaccacaggguagaaccacggac

 - 84

Get sequence
Deep sequencing1051 reads, 4 experiments
Evidence experimental; array [2], in-situ [2]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).