Stem-loop sequence dre-mir-142a

AccessionMI0002005 (change log)
DescriptionDanio rerio miR-142a stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   cgu        g               a         uaaacccc 
5'    acagugca ucauccauaaaguag aagcacuac        u
      |||||||| ||||||||||||||| |||||||||         
3'    ugucaugu aguagguauuucauc uuugugaug        c
   -gu        g               c         ugacaccg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 3170736-3170826 [+]
intergenic
Database links

Mature sequence dre-miR-142a-5p

Accession MIMAT0001838
Sequence

18 - 

cauaaaguagaaagcacuacu

 - 38

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-142a-3p

Accession MIMAT0003160
Sequence

55 - 

uguaguguuuccuacuuuaugga

 - 77

Get sequence
Evidence experimental; array [2], in-situ [2]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).