Stem-loop sequence dre-mir-142a

AccessionMI0002005
DescriptionDanio rerio miR-142a stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   cgu        g               a         uaaacccc 
5'    acagugca ucauccauaaaguag aagcacuac        u
      |||||||| ||||||||||||||| |||||||||         
3'    ugucaugu aguagguauuucauc uuugugaug        c
   -gu        g               c         ugacaccg 
Get sequence
Deep sequencing
128 reads, 61.2 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 3156809-3156899 [+]
intergenic
Database links

Mature sequence dre-miR-142a-5p

Accession MIMAT0001838
Sequence

18 - 

cauaaaguagaaagcacuacu

 - 38

Get sequence
Deep sequencing67 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-142a-3p

Accession MIMAT0003160
Sequence

55 - 

uguaguguuuccuacuuuaugga

 - 77

Get sequence
Deep sequencing45 reads, 4 experiments
Evidence experimental; array [2], in-situ [2]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).