Stem-loop sequence dre-mir-142b

AccessionMI0002006
DescriptionDanio rerio miR-142b stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
           g   cu          ac        uaaacuuc 
5' acagugca uca  cauaaaguag  agcacuac        u
   |||||||| |||  ||||||||||  ||||||||         
3' ugucaugu agu  guauuucauc  uugugaug        c
           g   ag          cu        ugacacau 
Get sequence
Deep sequencing
60 reads, 30.1 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 14402913-14402998 [-]
sense
OTTDART00000057104 ; mir142b-001; exon 1
ENSDART00000156757 ; mir142b-001; exon 1
Database links

Mature sequence dre-miR-142b-5p

Accession MIMAT0001839
Sequence

15 - 

cauaaaguagacagcacuacua

 - 36

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).