Stem-loop sequence dre-mir-143

AccessionMI0002007 (change log)
DescriptionDanio rerio miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

7 open access papers mention dre-mir-143
(17 sentences)

Stem-loop
     u  -     --c    gg    c g         g      u  -  aa 
5' ga cu acagu   gucu  cccg g ugcagugcu caucuc gg uc  c
   || || |||||   ||||  |||| | ||||||||| |||||| || ||   
3' cu ga uguca   cagg  gggc c augucacga guagag cu ag  u
     c  c     caa    -a    u g         a      u  g  gg 
Get sequence
Deep sequencing
73386 reads, 4.38e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The cloned mature miR-143 sequence always appears to be 22nt in length, modified by the addition of a 3' U residue not found in the genomic sequence [1].

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 38742313-38742411 [+]
intergenic
KZ115462.1: 17707-17805 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-143
dre-mir-143chr14: 38742313-38742411 [+]
dre-mir-145chr14: 38743941-38744053 [+]
Database links

Mature sequence dre-miR-143

Accession MIMAT0001840
Sequence

57 - 

ugagaugaagcacuguagcuc

 - 77

Get sequence
Deep sequencing73255 reads, 11 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).