Stem-loop sequence dre-mir-143-2

AccessionMI0002008
DescriptionDanio rerio miR-143-2 stem-loop
Gene family MIPF0000094; mir-143
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-143. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates. mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     u  -     --c    gg    c g         g      u  -  aa 
5' ga cu acagu   gucu  cccg g ugcagugcu caucuc gg uc  c
   || || |||||   ||||  |||| | ||||||||| |||||| || ||   
3' cu ga uguca   cagg  gggc c augucacga guagag cu ag  u
     c  c     caa    -a    u g         a      u  g  gg 
Get sequence
Deep sequencing
100 reads, 14.1 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The cloned mature miR-143 sequence always appears to be 22nt in length, modified by the addition of a 3' U residue not found in the genomic sequence [1].

Genome context
Coordinates (Zv9) Overlapping transcripts
14: 40238765-40238863 [+]
antisense
ENSDART00000114970 ; SPDL1-201; intron 10
Database links

Mature sequence dre-miR-143

Accession MIMAT0001840
Sequence

57 - 

ugagaugaagcacuguagcuc

 - 77

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).