Dead miRNA entry

miRNA accession:
MI0002008
miRNA ID:
dre-mir-143-2
Forward to:
MI0002007
Comment:
The sequences previously named mir-143-1 and mir-143-2 map to the same locus in the GRCz10 genome assembly. The entries are therefore merged.

Previous miRNA entry

Stem-loop sequence dre-mir-143-2

AccessionMI0002008 (change log)
DescriptionDanio rerio miR-143-2 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
     u  -     --c    gg    c g         g      u  -  aa 
5' ga cu acagu   gucu  cccg g ugcagugcu caucuc gg uc  c
   || || |||||   ||||  |||| | ||||||||| |||||| || ||   
3' cu ga uguca   cagg  gggc c augucacga guagag cu ag  u
     c  c     caa    -a    u g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The cloned mature miR-143 sequence always appears to be 22nt in length, modified by the addition of a 3' U residue not found in the genomic sequence [1].

Database links

Mature sequence dre-miR-143

Accession MIMAT0001840
Sequence

57 - 

ugagaugaagcacuguagcuc

 - 77

Get sequence
Deep sequencing73255 reads, 11 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).