Stem-loop sequence dre-mir-144

AccessionMI0002009
DescriptionDanio rerio miR-144 stem-loop
Gene family MIPF0000093; mir-144
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-144. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-144 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. In humans, miR-144 has been characterised as a "common miRNA signature" of a number of different tumours. GATA4 is thought to activate transcription of the miR-144 microRNA precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --------       a  c  g        g         --ag    u 
5'         gcucucu ga ag auaucauc uauacugua    uuca u
           ||||||| || || |||||||| |||||||||    ||||  
3'         uggggga cu uc uguaguag auaugacau    gagu a
   cgagcaac       c  a  a        -         caca    u 
Get sequence
Deep sequencing
1909 reads, 193 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 43890656-43890744 [-]
sense
OTTDART00000022480 ; si:ch211-207c6.2-001; exon 2
ENSDART00000137692 ; si:ch211-207c6.2-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-144
dre-mir-1445: 43890656-43890744 [-]
dre-mir-4515: 43890553-43890612 [-]
Database links

Mature sequence dre-miR-144-5p

Accession MIMAT0031975
Sequence

13 - 

ggauaucaucguauacuguaagu

 - 35

Get sequence
Deep sequencing1685 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-144-3p

Accession MIMAT0001841
Previous IDsdre-miR-144
Sequence

51 - 

uacaguauagaugauguacu

 - 70

Get sequence
Deep sequencing54 reads, 3 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).