Stem-loop sequence dre-mir-145

AccessionMI0002010 (change log)
Previous IDsdre-mir-145-1
DescriptionDanio rerio miR-145 stem-loop
Gene family MIPF0000079; mir-145
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-145. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-145 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        cu  aucauuu     u        uc    u  c             ggg a 
5' ucagu  uc       ccuca ccccgggg  cagu uu ccaggaaucccuu   c a
   |||||  ||       ||||| ||||||||  |||| || |||||||||||||   |  
3' aguca  ag       ggggu gggguucu  guca aa gguccuuaggggg   g u
        uc  ----guc     u        -u    u  a             aaa c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 38743941-38744053 [+]
intergenic
KZ115462.1: 19335-19447 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-145
dre-mir-143chr14: 38742313-38742411 [+]
dre-mir-145chr14: 38743941-38744053 [+]
Database links

Mature sequence dre-miR-145-5p

Accession MIMAT0001842
Previous IDsdre-miR-145
Sequence

30 - 

guccaguuuucccaggaauccc

 - 51

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-145-3p

Accession MIMAT0031976
Sequence

69 - 

ggauuccuggaaauacuguucu

 - 90

Get sequence
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).