Stem-loop sequence dre-mir-148

AccessionMI0002015 (change log)
DescriptionDanio rerio miR-148 stem-loop
Gene family MIPF0000056; mir-148
Literature search

3 open access papers mention dre-mir-148
(3 sentences)

Stem-loop
   c        -ua            a    cc    - uga 
5'  uuuccaag   aaguucugugau cacu  gacu c   a
    ||||||||   |||||||||||| ||||  |||| |   u
3'  gaggguuu   uucaagacauua guga  cuga g   g
   u        ugu            c    --    c uuu 
Get sequence
Deep sequencing
14980 reads, 827 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 1644683-1644761 [-]
sense
OTTDART00000033786 ; si:ch1073-172f18.2-001; exon 2
ENSDART00000157013 ; si:ch1073-172f18.2-001; exon 2
Database links

Mature sequence dre-miR-148

Accession MIMAT0001845
Sequence

49 - 

ucagugcauuacagaacuuugu

 - 70

Get sequence
Deep sequencing10860 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).