Stem-loop sequence dre-mir-148

AccessionMI0002015
DescriptionDanio rerio miR-148 stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c        -ua            a    cc    - uga 
5'  uuuccaag   aaguucugugau cacu  gacu c   a
    ||||||||   |||||||||||| ||||  |||| |   u
3'  gaggguuu   uucaagacauua guga  cuga g   g
   u        ugu            c    --    c uuu 
Get sequence
Deep sequencing
251 reads, 190 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
9: 1634030-1634108 [-]
sense
OTTDART00000033786 ; si:ch1073-172f18.2-001; exon 2
ENSDART00000157013 ; si:ch1073-172f18.2-001; exon 2
Database links

Mature sequence dre-miR-148

Accession MIMAT0001845
Sequence

49 - 

ucagugcauuacagaacuuugu

 - 70

Get sequence
Deep sequencing191 reads, 3 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).