Stem-loop sequence dre-mir-150

AccessionMI0002016
DescriptionDanio rerio miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ca    c           u      a        ugauu 
5'   ucuc gucucucccaa ccuugu ccaguguc     u
     |||| ||||||||||| |||||| ||||||||      
3'   ggag cgggggggguu ggggca ggucgcag     a
   ag    u           u      -        uagac 
Get sequence
Deep sequencing
483 reads, 57 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 32708285-32708363 [+]
antisense
OTTDART00000053538 ; si:ch73-367p23.6-001; exon 3
ENSDART00000151755 ; si:ch73-367p23.6-001; exon 3
Database links

Mature sequence dre-miR-150

Accession MIMAT0001846
Sequence

11 - 

ucucccaauccuuguaccagug

 - 32

Get sequence
Deep sequencing421 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).